circad | circRNAs associated with diseases

Circular RNA_LARP4
Gene	LARP4	Organism	Human
Genome Locus		Build	hg19
Disease	Ovarian Cancer	ICD-10	Other and unspecified female genital organs (D07.3)
DBLink		PMID	30468459
Experimental Method
Sample Type	Tissue and cell lines	Comparison	78 paired ovarian cancer tissue and adjacent normal tissue samples
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGGCATCAGGAGCAAACTTA Reverse CTGGCGAATTAAAGCCATTC	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Zou, T, Wang, PL, Gao, Y, Liang, WT (2018). Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis. Eur Rev Med Pharmacol Sci, 22, 21:7178-7182.